1. The modified structures at the border of the epithelium shown above are immotile in a 23-year-old patient. Which of the following would be a consequence of this lack of motility?

2. A 29-year-old epileptic sanitation engineer is maintained on primidone. Ultrastructural examination of a liver biopsy reveals increased amounts of smooth endoplasmic reticulum. This change is most closely related to increases in the activity of which of the following?

3. A 7-year-old patient presents with a mass in the anterior midline of the neck, slightly above the larynx. The mass is mobile and elevates upon protrusion of the tongue. This mass is most likely a cyst that developed from which of the following embryonic structures?

4. A baby who was apparently normal at birth, develops persistent regurgitation and vomiting in the second and third weeks of life. No fever is present and hematologic studies and blood chemistries are normal. Which of the following therapies is most likely to be effective in this case?

5. A 24-year-old woman presents with a 3-day history of fever, chills, chest pain, and cough productive of rust-colored sputum. Past medical history includes a splenectomy 1 year ago. A chest x-ray film indicates consolidation of the right lower lobe. Blood cultures are positive for a-hemolytic gram-positive diplococci. Immunity to the causative organism is based on

6. The leukocyte pictured above stains intensely with acidic dyes such as eosin. Which of the following substances is contained in the crystalline core of the granule at the arrow?

7. What is the primary function of the cell pointed to in the figure above?

8. An 8-month-old female child is brought to medical attention because her first four teeth show several discrete, discolored, circumferential bands that show very little enamel. Excessive levels of which of the following may have produced this defect?

9. A 24-year-old woman in her third trimester of pregnancy presents with urinary frequency and burning for the past few days. She denies fever, nausea, vomiting, or chills. She takes no medications besides prenatal vitamins and is generally in good health. Physical examination is remarkable for mild suprapubic tenderness, and a urine dipstick is positive for white blood cells, protein, and a small amount of blood. Culture produces greater than 100,000 colonies of gram-negative bacilli. which of the following attributes of this uropathogenic organism is most strongly associated with its virulence?

10. A 72-year-old male is noted as having a 9-pound weight loss over the past few weeks. His past medical history is significant for oat cell carcinoma of the lung, without known metastases, for which he is currently undergoing treatment. The patient states that even though his wife is preparing his favorite meals, he is not hungry. Which of the following would be the best treatment option to improve his eating habits?

11. A 33-year-old woman presents with fever, vomiting, severe irritative voiding symptoms, and pronounced costovertebral angle tenderness. Laboratory evaluation reveals leukocytosis with a left shift; blood cultures indicate bacteremia. Urinalysis shows pyuria, mild hematuria, and gram-negative bacteria. Which of the following drugs would besttreat this patient's infection?

12. A 33-year-old woman presents with fever, vomiting, severe irritative voiding symptoms, and pronounced costovertebral angle tenderness. Laboratory evaluation reveals leukocytosis with a left shift; blood cultures indicate bacteremia. Urinalysis shows pyuria, mild hematuria, and gram-negative bacteria. Which of the following drugs would best treat this patient's infection?

13. A surgeon performs an exploratory laparotomy, producing a large incision in the patient's abdomen. Poor blood supply to which of the following is most likely to cause problems during the healing process?

14. In a genotypic male, the testes fail to develop, and do not secrete testosterone or Müllerian regression factor. Which of the following best describes the in utero reproductive system development of this individual?

15. Which of the following structures is found only in Gram-negative microorganisms?

16. A 57-year-old female is found unconscious on her kitchen floor after having suffered a myocardial infarction. She has pulmonary edema and distended jugular and peripheral veins. A midsystolic gallop is heard upon chest auscultation. EKG shows prominent Q waves in leads II, III, and aVF. Which of the following is most consistent with the patient's condition?

17. A 32-year-old, blood type A positive male receives a kidney transplant from a blood type B positive female donor with whom he had a 6-antigen HL A match. Once the kidney is anastomosed to the man's vasculature, the transplant team immediately begins to observe swelling and interstitial hemorrhage. After the surgery, the patient developed fever and leukocytosis and produced no urine. Which of the following is the most likely explanation?

18. A 67-year-old black man with a history of glucose-6-phosphate dehydrogenase (G-6-PD) deficiency presents with fever, irritative voiding symptoms, and perineal pain. Rectal examination is remarkable for a boggy, exquisitely tender prostate. A urine Gram's stain is positive for gram-negative rods. The risk for development of hemolytic anemia is highest if he receives high-dose, 21-day therapy with

19. A 2-year-old retarded child is evaluated by a metabolic specialist. The child's history is significant for failure to thrive and progressive neurologic deterioration, including deafness and blindness. Physical examination is remarkable for hepatosplenomegaly , as well as a cherry-red spot on funduscopic examination. These symptoms are consistent with a diagnosis of

20. A 42-year-old female presents with a recent onset of fatigue, malaise, constipation, and a 12-pound weight gain. On examination, her thyroid is firm and enlarged. What laboratory test is most likely to confirm the expected diagnosis?

21. A 20-year-old develops weakness accompanied by difficulty in relaxation that is most pronounced in the hands and feet. Muscle biopsy demonstrates prominent ring fibers, centrally located nuclei, chains of nuclei, and disorganized sarcoplasmic masses. This condition been associated with a mutation on which of the following chromosomes?

22. The heart of an embryo first begins beating at which of the following ages?

23. A 45-year-old man presents to the emergency department with severe headache and vomiting. A CT scan shows a well-circumscribed cystic lesion within the 3rd ventricle; there is no calcium deposition. The cyst is surgically removed. On histologic examination, the wall of the cyst consists of a single layer of mucin-producing columnar epithelium with a ciliated apical surface. Which of the following is the most likely diagnosis?

24. A patient develops a swollen and tender lymph node in his popliteal fossa. An infected skin lesion in which of the following sites would most likely induce lymphadenopathy in this region?

25. Maintenance of the corpus luteum during the first trimester of pregnancy is accomplished principally by the secretion of

26. A patient with prolonged diarrhea undergoes esophagogastroduodenoscopy. Biopsy of the small intestine demonstrates numerous crescent-shaped protozoa adjacent to the epithelial brush border. Which of the following organisms is the most likely pathogen?

27. A 45-year-old homeless man has a chronic cough, a cavitary lesion of the lung, and is sputum positive for acid-fast bacilli. Which of the following is the principle form of defense by which the patient's body fights this infection?

28. A 25-year-old woman with sickle cell anemia complains of steady pain in her right upper quadrant with radiation to the right shoulder, especially after large or fatty meals. Her physician diagnoses gallstones. Of which of the following compounds are these stones most likely composed?

29. A 72-year-old male is noted as having a 9-pound weight loss over the past few weeks. His past medical history is significant for oat cell carcinoma of the lung, without known metastases, for which he is currently undergoing treatment. The patient states that even though his wife is preparing his favorite meals, he is not hungry. Which of the following would be the best treatment option to improve his eating habits?

30. A 24-year-old woman in her third trimester of pregnancy presents with urinary frequency and burning for the past few days. She denies fever, nausea, vomiting, or chills. She takes no medications besides prenatal vitamins and is generally in good health. Physical examination is remarkable for mild suprapubic tenderness, and a urine dipstick is positive for white blood cells, protein, and a small amount of blood. Culture produces greater than 100,000 colonies of gram-negative bacilli. Which of the following attributes of this uropathogenic organism is most strongly associated with its virulence?

31. A 7-year-old boy is brought to a physician because of a nearly confluent, fine, erythematous, macular rash that is most pronounced on his trunk. He has had a mild fever for 36 hours, but does not appear very sick, and is happily playing when the pediatrician enters the examining room. Physical examination demonstrates a reddened throat with tonsillar exudates, enlarged cervical nodes including the occipital node, and questionable splenomegaly. The mother says that the boy has not been coughing, and no Koplik spots are noted. Which of the following is the most likely diagnosis?

32. A 25-year-old female presents with a confluent maculopapular rash that began on her face, then spread downward over her trunk. She states that 3 days ago she started having a fever and headache, with bilateral pain associated with the front and back of her neck. She also complains of joint pain. Which of the following diseases does she most likely have?

33. A 67-year-old black man with a history of glucose-6-phosphate dehydrogenase (G-6-PD) deficiency presents with fever, irritative voiding symptoms, and perineal pain. Rectal examination is remarkable for a boggy, exquisitely tender prostate. A urine Gram's stain is positive for gram-negative rods. The risk for development of hemolytic anemia is highest if he receives high-dose, 21-day therapy with

34. A patient who has been exhibiting various endocrine abnormalities has an MRI scan of the head. This scan reveals a small tumor of the pituitary gland. If this tumor expands laterally, which of the following nerves will most likely be affected first?

35. A 52-year-old female presents with groin pain . Physical examination reveals a bulge in the groin area immediately inferior to the inguinal canal. The physician suspects that the patient has a femoral hernia containing a loop of small intestine. Which of the following structures is located immediately medial to the hernia sac?

36. A patient with tuberculosis develops bright orange-red urine and calls his physician in a panic because he is afraid he is bleeding into the urine. The patient has no other urinary tract symptoms. Which of the following medications is most likely to produce this side effect?

37. A pregnant southeast Asian immigrant presents for prenatal care. Her past medical history is significant for a severe illness 3 years ago characterized by fatigue, nausea, anorexia, vomiting, jaundice, joint pains, and generalized skin lesions that slowly disappeared. She has felt well recently. Which of the following laboratory tests should be ordered to investigate the patient's past illness?

38. A 49-year-old Vietnamese man is diagnosed with tuberculosis. On physical examination, large flocculent masses are noted over the lateral lumbar back , and a similar mass is located in the ipsilateral groin. This pattern of involvement strongly suggests an abscess tracking along the

39. A 56-year-old man visits his physician with complaints of complete exhaustion after mowing the lawn in his small front yard. He also complains of dizziness, irritability, difficulty sleeping, and loss of libido. On physical examination, the man's skin, conjunctiva, and oral mucosa are pale. A blood test indicates the man's hemoglobin is 7 g/dL. Which of the following findings is also likely to be present in this man?

40. A 25-year-old male gets into a brawl outside a bar. During the altercation, someone pulls out a gun and shoots him in the head. The bullet enters the man's temple and severs his right optic nerve completely. He is quickly transported to a nearby emergency room and an emergency physician tests his pupillary response by shining a light in the right eye. What will the physician most likely find?

41. A 45-year-old male presents to the physician with muscle cramps, perioral numbness, and irritability over the past 3 to 4 months. Lab results reveal hypocalcemia, normal albumin level, and hyperphosphatemia. Parathyroid hormone level is decreased. Alkaline phosphatase level is normal. Which of the following is most likely causing this clinical scenario?

42. A child with sickle cell anemia is seen in a hematology clinic. Her mother states that she has been feeling very tired lately, and may have "come down with a virus." On physical examination, the girl is very pale, and a complete blood count shows severe anemia. A bone marrow aspirate contains no erythroid precursor cells. The girl was probably infected with which of the following viruses?

43. A 35-year-old woman notices a change in the appearance of a mole on her neck. Physical examination reveals that the lesion is an irregular, nodular, superficial mass with a variegated appearance. Biopsy demonstrates a primary malignant tumor. Which of the following factors is most predictive of the patient's long term prognosis?

44. Which of the following metabolic processes occurs exclusively in the mitochondria?

45. A 46-year-old woman visits her podiatrist to have several bunions removed from her right foot. She chooses conscious sedation rather than general anesthesia for this procedure. She is given intravenous midazolam to supplement the local anesthetics that are injected into her foot. Midway through the surgery, she suddenly becomes agitated, combative, and exhibits involuntary movements. The anesthesiologist determines that she is having a paradoxical reaction to the midazolam and immediately administers

46. An 80-year-old woman dies after a long history of progressive memory loss, apraxia, and recurrent episodes of confusion. In the last months of life she was bedridden and unable to recognize familiar faces and objects. The pathologist identifies numerous flame-shaped intracytoplasmic inclusions in neurons of the neocortex and hippocampus. These consist of paired helical filaments (PHFs) on electron microscopy. Which of the following biochemical changes most likely accounts for the development of PHFs in this condition?

47. Most fascia of the body that attach to bones attach by which of the following mechanisms?

48. Which of the following Starling force changes is the primary cause of the edema seen in patients with nephrotic syndrome?

49. A 71-year-old man has been in excellent health, and practicing competently as an attorney. He is brought to the emergency room following a motor vehicle accident. A workup, including imaging of the spine, thorax, and head, is negative, but the patient is admitted for overnight observation. His injuries include several lacerations to the face and extremities as well as several contusions to the thorax. Three weeks later, he is admitted to the hospital for confusion. A neurologic exam is normal except that he is not oriented to time or place, and can recall only 1 out of 6 objects after 3 minutes. Which of the following is the most likely diagnosis?

50. A newborn baby has a prominent defect at the base of his spine through which his meninges and spinal cord protrude. A failure of which of the following processes is the most common cause of this type of defect?

51. A 21-year-old college student from Connecticut with a past history of Lyme disease presents with chronic pain and swelling in his right knee. He states that he has had problems with the knee for the past two years. Which of the following HLA alleles would you expect to be present in this individual?

52. A research scientist is studying calcium fluxes in cultured cells using confocal laser scanning microscopy. The magnitude of the signal (brightness) is proportional to the strength of the calcium flux. Stimulation of which of the following receptor types would be expected to produce the strongest signal?

53. A cardiovascular physiologist is performing experiments using a new alpha1 adrenergic agonist to determine the amount of vasoconstriction the new drug can produce compared with a phenylephrine control. Which of the labeled structures is the cellular target of both of these drugs?

54. The maximum expiratory flow-volume curve shown above is created when the patient inhales as much air as possible and then expires with maximum effort until no more air can be expired. What is the forced vital capacity of this patient?

55. A liver biopsy from a 54-year-old man shows many Mallory bodies. This finding is most suggestive of which of the following diseases?

56. Zygomycosis, a destructive fungal infection of the sinuses, is likely to reach the brain by which of the following routes?

57. A neuroscientist is investigating the development of the nervous system. In his experiments, he microinjects a dye into the embryo of an animal subject in vivo. After birth, he performs histological studies to determine the destination of the dye. In one animal subject, he locates the dye in the dorsal horn of the spinal cord. Which of the following locations in the embryo was the most likely site of the injection?

58. A 43-year-old executive presents to a physician with chronic, symmetric polyarthritis involving the knees. The man gives a history of having developed an extensive rash after a deer hunting trip in Connecticut several years earlier. He recalls that he felt "sick" at the time, and developed knee pain that prevented him from climbing stairs for several months, but then partially resolved. Which of the following organisms is most likely etiologically related to the patient's arthritis?

59. An active intravenous drug abuser presents to the emergency department with fever of 5 days' duration, a cough occasionally productive of blood, and pleuritic chest pain. Petechiae are present in his mouth and conjunctivae, and splinter hemorrhages are visible under the fingernails. Which of the following test results would most likely confirm the identity of the causative agent?

60. An elderly woman with a history of multiple oral ulcers presents with flaccid bullae on her scalp, face, and trunk. Manual pressure on the skin produces separation of the upper layer of the epidermis, followed by eventual sloughing of the skin. The patient has been in relatively good health until recently, and denies taking any medications. A biopsy of one of the skin lesions reveals separation of epithelial cells above the basal layer. Autoantibodies to which of the following components would most likely be found in this patient?

61. A 70-year-old man with a history of atrial fibrillation is started on an oral anticoagulant. His prothrombin time is monitored on a regular basis. A few months into his therapy, he begins treatment for a duodenal ulcer and he develops symptoms of a bleeding diathesis. Which of the following ulcer medications is most likely responsible for this change in his hemostatic status?

62. A patient has a painful ulcer on the tip of his tongue. Which of the following cranial nerves carries the pain sensation he experiences?

63. A 48-year-old man complaining of chest pain is brought to the emergency room. Physical examination followed by echocardiography demonstrates aortic stenosis. His coronary blood flow is increased. Which of the following is the most likely explanation for the increased coronary blood flow in this individual?

64. A 37-year-old woman is abducted, beaten, and repeatedly raped. For five months after the attack she is nervous, tearful, easily fatigued, and has difficulty concentrating. She also notes difficulty sleeping and lack of appetite, and is hyperreactive to unexpected or loud stimuli. By six months she has returned to her characteristic pre-attack behavioral patterns. Which of the following is the most likely diagnosis?

65. Five days after returning to his military base in South Carolina after survival training in the nearby countryside, an 18-year-old recruit reports to the infirmary complaining of a headache. Physical examination reveals a fever, but no other abnormalities are noted. A few days later he returns to the infirmary with a maculopapular rash involving the hands and feet. The rash then spreads centripetally to involve the trunk. Which of the following diseases should be suspected?

66. A 15-year-old girl in a rural community has swollen, painful lymph nodes in her right axilla. Physical examination reveals multiple scratches on her right arm with a papule associated with one of the scratch marks. She states that the scratches occurred about 5 days ago. What type of animal is the most likely source of the infection?

67. A 2-year-old child presents to the pediatrician with hematuria. Examination reveals hypertension and an abdominal mass. A tumor is localized to the right kidney and biopsy reveals a stroma containing smooth and striated muscle, bone, cartilage, and fat, with areas of necrosis. The gene for this disorder has been localized to which of the following chromosomes?

68. A person lifts one foot prior to taking a step. Which of the following nerves innervates the muscle group that allows the person to maintain balance by holding the weight of his body over the foot remaining on the ground?

69. Which of the following is the primary opsonin in the complement system?

70. An elderly man comes to medical attention because of anemia and multiple infections. Physical examination is remarkable for hepatosplenomegaly. An automated blood count demonstrates pancytopenia. Review of the peripheral smear by a hematologist demonstrates rare, distinctive, neoplastic white cells covered by fine, hairlike projections. Which of the following characteristics would likely be associated with these cells?

71. A 36-year-old Asian male complains of difficulty swallowing. Esophagoscopy reveals a polypoid mass that is subsequently biopsied. In addition to tumor cells, the esophageal biopsy show normal smooth muscle and striated muscle in the same section. Which portion of the esophagus was the source of this biopsy?

72. An otherwise healthy 3-year-old child is brought to the pediatrician with umbilicated, flesh-colored papules on his trunk. This condition is related to infection with which of the following viruses?

73. A patient with a cavitary lung lesion coughs up sputum that contains thin, acid-fast positive rods. Which of the following features would most likely be associated with these bacteria?

74. A patient complaining of chest pain with exercise is evaluated by cardiac catheterization. The left anterior descending (LAD) branch of the coronary artery is visualized but the contrast angiography is poor. A Doppler-tipped catheter is inserted and the blood velocity is observed to increase transiently from 10 cm/sec to 70 cm/sec and then decrease back to 10 cm/sec as the probe passes a particular location in the artery. What was the cause of these changes in velocity measurements?

75. A 33-year-old single mother of two young children visits her physician because of an oral ulcer. A review of systems is significant for fatigue, myalgia, and joint pain. Laboratory results demonstrate leukopenia, and a high-titered antinuclear antibody. A speckled staining pattern due to anti-Sm is seen with immunofluorescence; urinary protein is elevated. Which of the following is the most likely diagnosis?

76. The table below shows the fall in blood pressure that occurs for the various types of blood vessels as blood flows from the aorta (100 mm Hg) to the right atrium (0 mm Hg). Which of the following types of blood vessel is likely to have the highest ratio of wall cross-sectional area to lumen cross-sectional area

77. A chronic alcoholic develops severe memory loss with marked confabulation. Deficiency of which of the following vitamins would be most likely to contribute to the neurologic damage underlying these symptoms?

78. Microscopic examination of a cancer cell reveals a cell in an abnormal telophase in which three clusters of chromosomes are seen. An abnormality of which of the following would be most likely to produce this alteration?

79. A healthy, 37-year-old, recently divorced woman loses her job at the auto factory. She picks up her three young children from the factory day care center and gets into an automobile accident on the way home. Her 5-year-old son, who was not wearing a seat belt, sustains a severe head injury. The woman was not hurt in the accident, but is hyperventilating as she sits in the waiting room at the hospital. She complains of feeling faint and has blurred vision. Which of the following is decreased in this woman?

80. A patient develops a form of lung cancer that spreads to occlude the thoracic duct. Edema involving which of the following sites might be expected as a potential complication?

81. A patient with familial hypercholesterolemia undergoes a detailed serum lipid and lipoprotein analysis. Studies demonstrate elevated cholesterol in the form of increased LDL without elevation of other lipids. This patient's hyperlipidemia is best classified as which of the following types?

82. A 38-year-old pregnant woman with a past medical history significant for chronic hypertension presents with a blood pressure of 158/105 mm Hg. Which of the following antihypertensive agents would be most suitable for initial therapy in this patient?

83. A 38-year-old AIDS patient presents to the clinic complaining of nausea, occasional vomiting and "bumps" on his groin. On physical examination, multiple, nontender, pedunculated reddish purple nodules in the inguinal and perirectal areas are observed. The patient's liver is palpable 8 cm below the right costal margin. Routine laboratory tests are unremarkable except for an alanine aminotransferase level of 58 and alkaline phosphatase of 90. He denies any foreign travel, but has two pet cats . Which of the following is the most likely cause of this patient's infection? A. Bartonella henselae

84. A patient is referred to a neurologist because of ataxia. Neurological examination reveals a loss of proprioception and a wide-based, slapping gate Magnetic resonance imaging reveals degeneration of the dorsal columns and dorsal roots of the spinal cord. Which of the following organisms is most likely to have caused this pattern of damage?

85. A 36-year-old mother of two children presents with a 4-day history of swollen, painful hands. Her wrists and metacarpophalangeal joints are boggy and inflamed bilaterally. Her 5-year-old son had been sent home from school approximately 3 weeks previously with red cheeks and a blotchy rash on his torso. What is the most likely diagnosis?

86. A sexually active 18-year-old woman presents with a fever of 102 F for the past 24 hours and lower abdominal pain and anorexia for the past 5 days. On physical examination, there is generalized tenderness of the abdomen, and the cervix is erythematous with motion tenderness. There is no rash nor any lesions on the external genitalia. A smear of the odorless cervical discharge contains sloughed epithelial cells and scant neutrophils. Which of the following would likely be found in the exudate?

87. Contraction of which of the following muscles contributes most to the backward movement of the lower jaw during the process of mastication?

88. An increase in which of the following best explains the mechanism by which the cardiac output increases in severe anemia?

89. The left adrenal vein drains directly into which of the following veins?

90. A premature infant develops progressive difficulty breathing over the first few days of life. Deficient surfactant synthesis by which of the following cell types may have contributed to the baby's respiratory problems?

91. A 55-year-old man had been in good health since receiving a heart transplant for severe atherosclerotic disease. Five years after transplantation, the patient died suddenly, without any premonitory symptoms, while working in his garden. He had been maintained on cyclosporin since his transplant. Which of the following complications would most likely be found at autopsy in the transplanted heart?

92. In which of the following organs are fenestrated endothelial cells common?

93. A 40-year-old, moderately obese man presents with a persistent productive cough. The cough has been present for several weeks, but recently the man noted that his sputum has assumed a greenish color. Further questioning elicits a history of productive cough, usually in the winter months, over the past several years. He has smoked two packs of cigarettes per day since he was 16 years old. On examination, the man is febrile (100° F), and coarse rhonchi and wheezes can be appreciated bilaterally. Which of the following is the most likely diagnosis?

94. A 58-year-old man with fainting spells and exercise intolerance is found to have a bicuspid aortic valve with marked aortic stenosis. Which of the following physical findings would be prominent in this patient?

95. An alert pediatric intern notices that a neonate with dysmorphic facies is twitching abnormally. As he watches, the baby experiences a seizure. Stat laboratories indicate a glucose of 90, serum sodium of 140, serum potassium of 4.2 and serum calcium of 3.9. Over the next several months, the child is admitted to the hospital twice for Candida infections, and once for a viral exanthem. Which of the following is the most likely diagnosis?

96. A 24-year-old woman attempts suicide by taking an overdose of diazepam. She is rushed to the emergency department, where the attending physician will most likely order which of the following treatments?

97. During embryological development, hematopoiesis occurs in different organs at different times. Which of the following are the correct organs, in the correct sequence, at which hematopoiesis occurs embryologically?

98. A patient, who appears to be female, is found to be 46,XY. The patient's vagina is very shallow, ending in a blind pouch, and there are palpable masses in the labia. The diagnosis of testicular feminization syndrome is made. Which of the following was most likely present during the early fetal life of this individual?

99. A 50-year-old physician is recovering from aseptic meningitis that began two weeks ago. He appears to have lost considerable cognitive function, and he says he will not go on living if his cognitive ability remains compromised. To demonstrate to him that recovery is occurring, serial evaluations with which of the following psychological assessments is indicated?

100. A pulmonologist is testing a patient's lung volumes and capacities using simple spirometry. Which of the following lung volumes or capacities cannot be measured directly using this technique?

101. One week following a visit to the woods along an Eastern seaboard beach, a 50-year-old woman develops fever, headache, chills, and fatigue. A blood smear demonstrates protozoa within erythrocytes. Which of the following is the most likely pathogen?

102. A 7- year-old girl develops behavioral changes, and her performance in school begins to deteriorate. Several months later she develops a seizure disorder, ataxia, and focal neurologic symptoms. She is eventually quadriparetic, spastic, and unresponsive. Death occurs within a year. This patient may have had which of the following viral diseases at 1 year of age?

103. A 43-year-old, insulin-dependent diabetic patient is diagnosed with hypertension and begins therapy with an antihypertensive agent. Three days later, he measures his blood glucose at home and finds that it is 53 mg/dL. He recalibrates his glucose testing apparatus and repeats the test, only to find that the first reading was accurate. He is concerned that his hypoglycemia did not produce the normal premonitory signs and symptoms. Which of the following medications was most likely prescribed to treat his hypertension?

104. The activity of which of the following enzymes is directly affected by citrate?

105. A previously healthy 11-year-old girl develops a gastrointestinal infection with cramping and watery stools. After several days, she begins to pass blood per rectum, and is hospitalized for dehydration. In the hospital, she is noted to have decreasing urine output with rising blood urea nitrogen (BUN). Total blood count reveals anemia and thrombocytopenia, and the peripheral smear is remarkable for fragmented red cells (schistocytes). Infection with which of the following bacterial genera is most likely responsible for this syndrome?

106. A 3-year-old male presents with a skin rash and epistaxis. He has had several, severe sinopulmonary infections. A careful history reveals that his maternal grandfather died of bleeding complications following an emergency cholecystectomy. What additional findings are likely in this case?

107. IV administration of drug X to an anesthetized animal produces an increase in blood pressure. After administration of drug Y, readministration of drug X produces a decrease in blood pressure. Which of the following pairs of drugs could produce this sequence of events?

108. Which of the following amino acids is post-translationally hydroxylated in the cytoplasm of fibroblasts?

109. A 54-year-old woman suffering from influenza deteriorates and develops shaking chills and a high fever. Physical examination is remarkable for dullness to percussion at the left base and decreased breath sounds on the left. Chest x-ray confirms the diagnosis of lobar pneumonia, presumed to be caused by Streptococcus pneumoniae. The patient has no known drug allergies. Which of the following antibiotics would be most appropriate to treat the patient's condition?

110. A 2-year-old child with leukemia develops nephrotic syndrome. Light microscopic studies are normal. Electron microscopic studies demonstrate fusion of epithelial foot processes. The current hypothesis for the pathogenesis of this change is that it is secondary to which of the following?

111. A 48-year-old white female secretary presents with progressive difficulty typing over the past month. She also notes that her hands begin to feel numb and weak after typing for long periods of time. Upon testing, which of the following deficits would be predicted?

112. A child develops a tumor of the cerebellum. Biopsy reveals evidence of both neuronal and glial differentiation. Which of the following is the most likely diagnosis?

113. A 37-year-old, intravenous drug-abusing male presents with fever and chills. Blood cultures are positive for Staphylococcus aureus. He develops central nervous system symptoms, and a cerebral abscess is suspected. Which part of the brain is most often affected by septic emboli in patients with infective endocarditis?

114. A 1-year-old girl presents with a 2-day history of fever, vomiting, and watery, nonbloody diarrhea. On physical exam, she appears dehydrated. Which of the following best describes the most likely infecting organism?

115. A 27-year-old white male presents with a 3-week history of several swollen and painful toes and knees. He has a past history of conjunctivitis. He also describes some low back stiffness that is more severe in the morning. Which of the following is the most likely diagnosis?

116. A surgical pathology specimen from a 24-year-old woman seen at a reproductive medicine clinic demonstrates a ciliated columnar epithelium. From which of the following locations in the female genital tract was the biopsy obtained?

117. Which of the following organisms is the most common cause of community-acquired pneumonia?

118. A 34-year-old woman presents with fatigue, malaise, and swollen, tender joints. Physical examination is significant for a maculopapular eruption over sun-exposed areas, including the face. Examination of a peripheral blood smear reveals mild thrombocytopenia. Which of the following autoantibodies, if present, would be most specific for the diagnosis of the patient's disorder?

119. A 6-month-old boy is brought to the pediatrician by his parents, who are first cousins. This is their first child. Physical examination reveals a small, thin, lethargic infant with slightly misshapen long bones. His features are somewhat coarse. Joint movements are restricted, his corneas are clouded, and his gums are underdeveloped. His liver is not enlarged. Serum levels of acid hydrolases are found to be elevated. The child most likely has a defect in which of the following metabolic activities?

120. A 3 year-old boy is brought to a physician because the mother notices tha t the child is engaging in less active play and tires easily. During physical examination, the pediatrician notices that the child's thighs are larger than normal for age and that the child cannot stand up without using his arms to help. Further studies demonstrate a defective dystrophin gene in the boy. Which of the following people in the child's family is most likely to also have this disease?

121. A 73-year-old woman with a history of diabetes presents with left ear pain and drainage of pus from the ear canal. She has swelling and tenderness over the left mastoid bone. Which of the following microorganisms is the most likely causative agent?

122. A 45-year-old homeless man has a chronic cough, a cavitary lesion of the lung, and is sputum positive for acid-fast bacilli. Which of the following is the principle form of defense by which the patient's body fights this infection?

123. The parents of a 6-month-old child who was normal at birth bring her into the clinic. Since their emigration to the U.S. from Eastern Europe soon after her birth, the child has developed diminished responsiveness, progressive blindness and deafness, and recently, seizures. Serum levels of which of the following compounds would be expected to be decreased in both of the parents?

124. A 4-year-old boy is seen by his pediatrician for epistaxis. The patient has a history of multiple bacterial and viral respiratory tract infections and eczema. An uncle had similar problems. Physical examination is remarkable for multiple petechial lesions on the skin and mucous membranes. Serum IgE is increased, and platelets are decreased. Which of the following is the most likely diagnosis?

125. A 32-year-old, blood type A positive male receives a kidney transplant from a blood type B positive female donor with whom he had a 6-antigen HLA match. Once the kidney is anastomosed to the man's vasculature, the transplant team immediately begins to observe swelling and interstitial hemorrhage. After the surgery, the patient developed fever and leukocytosis and produced no urine. Which of the following is the most likely explanation?

126. A 35-year-old woman notices a change in the appearance of a mole on her neck. Physical examination reveals that the lesion is an irregular, nodular, superficial mass with a variegated appearance. Biopsy demonstrates a primary malignant tumor. Which of the following factors is most predictive of the patient's long term prognosis?

127. A patient develops an acute febrile illness with shivers, nonproductive cough, and pleuritic chest pain. Five days later, he presents to the emergency room after abruptly having "coughed up" nearly a cup of blood-stained sputum. Which of the following is most likely to be seen on chest x-ray?

128. A boy with Duchenne muscular dystrophy (DMD) was born to parents with no family history of the disease. The most likely explanation for this occurrence is

129. A 47-year-old male presents with declining renal function characterized by oliguria, elevated blood urea nitrogen and creatinine, and hematuria . He also complains of nasal congestion and epistaxis. Review of systems is notable for occasional cough and hemoptysis. Examination shows mucosal ulceration and nasal septal perforation, but no polyps. Which of the following serum markers would likely be present in this case?

130. A 60-year-old male with angina comes to the emergency room with severe chest pain unresponsive to sublingual nitroglycerin. An EKG shows ST segment elevation in the anterolateral leads, and thrombolytic therapy is initiated. If streptokinase is given to this patient, it may produce thrombolysis after binding to which of the following proteins?

131. A 52-year-old woman has long-standing rheumatoid arthritis (RA) and is being treated with corticosteroids and nonsteroidal anti-inflammatory drugs (NSAIDs). Which of the following cardiac complications may arise in this clinical setting?

132. A 15-year-old boy is evaluated by a clinician for failure to develop normal male secondary sexual characteristics. Physical examination reveals small testes, a small penis, and gynecomastia. The boy has had some difficulties in school, and the parents say that the school psychometrist said he had an IQ of 90. This patient's condition is most likely to be related to which of the following?

133. An obese patient is brought into the emergency room in shock and in need of intravenous fluids. No superficial veins can be seen or palpated. The emergency room physician decides to make an incision to locate the great saphenous vein for the insertion of a cannula ("saphenous cutdown"). In which of the following locations should the incision be made?

134. A 36-year-old female is brought to the emergency room by her husband who says that she "complained of a severe headache then lost consciousness." She has a history of hypertension and had been on several different medications. The examining physician notes that she is unable to move her arms and legs, but can blink her eyes. When the physician asks her to blink twice if she can hear him, she promptly does so. In which of the following structures is this woman's lesion most likely located?

135. Which of the following organisms is most likely to be implicated as a cause of urethritis that persists after antibiotic therapy for gonorrhea?

136. Which of the following respiratory system components is derived

137. A newborn in the neonatal intensive care unit becomes tachypneic and irritable. Blood cultures grow a gram-positive coccus in chains that is presumed to be a streptococcus. Which of the following characteristics would help to differentiate Streptococcus agalactiae from Streptococcus pneumoniae?

138. A 27-year-old woman presents to the emergency department complaining of 10-12 episodes of nonbloody diarrhea per day for the past 2 days, along with severe abdominal cramps, nausea, vomiting, and a low-grade fever. She states that she just returned from a vacation to Mexico. While in Mexico, she did not drink any of the local water and ate only cooked foods and a few fresh salads. If fecal leukocytes are present, the patient should most likely be empirically treated with

139. A 26-year-old man is admitted through the emergency department to the hospital for a heroin overdose. His heart rate is 45 beats/min, and his blood pressure is 75/40 mm Hg. Which of the following best depicts the results from an arterial blood sample?

140. HbNl: AAGUAUCACUAAGCUCGC HbCr: AAGAGUAUCACUAAGCUCGCUUUC ... UAU UAA Hemoglobin is isolated from the erythrocytes of a young child with anemia. Hemoglobin electrophoresis reveals the presence of an unstable hemoglobin, known as hemoglobin Cranston (HbCr), containing an abnormal b-globin chain. The normal sequence of the b-globin gene (HbNl) and the sequence of the HbCr b-chain are presented above. Which of the following would account for the development of HbCr?

141. A 32-year old women complains of amenorrhea since delivery of a baby 15 months previously, despite the fact that she did not breast feed her baby. The delivery was complicated by excessive hemorrhage that required transfusion of 2.5 liters of blood. She has also been fatigued and has gained an additional 10 pounds since the baby was born. Laboratory data show the following: Serum LH < 1 IU/L (normal, 4-24 IU/L) Serum estradiol 5 pg/mL (normal, 20 - 100 pg/mL) Serum TSH 0.1 mU/L (normal, 0.5 - 5 mU/L) Serum GH 3 ng/mL (normal, < 5 ng/mL) Serum ACTH 28 pg/mL (normal, 10 - 50 pg/mL) Serum prolactin 2 ng/mL (normal, <20 ng/mL) Injection of 500 mg of TRH failed to produce the expected rise in both serum TSH and prolactin. Which of the following diagnoses most likely explains the findings in this patient?

142. A 64-year-old man presents to his doctor with aching, burning pain afte r meals. He had been self-medicating for several months with antacids, but he found this to be increasingly ineffective. His physician decides to take him off the antacids and instead places him on a combination of ranitidine and sucralfate. Why is this combination a bad idea?

143. A particular association determines membership on the basis of members' IQ scores. Only those persons who have documented IQ scores at least 2 standard deviations above the mean on the Wechsler Adult Intelligence Scale (WAIS) are eligible for admission. Of a group of 200 people randomly selected from the population at large, how many would be eligible for membership to this society?

144. An archaeologist who has been excavating a very old Middle Eastern site develops a pustule on his hand. The pustule then ruptures to form a black eschar surrounded by expanding brawny edema. Which of the following organisms is the most likely cause of this condition?

145. A 20-year-old female presents with a two day history of dysuria and increased urinary frequency. She states that she was recently married and was not sexually active prior to the marriage. Physical exam reveals a temperature of 100.7 蚌 with normal vital signs. Gynecological exam reveals no evidence of discharge, vaginitis, or cervicitis. Urinalysis reveals 14 white blood cells per high-powered field with many gram-negative rods. The most appropriate therapy would be

146. A 10-year-old child is suspected of having pellagra because of chronic symptoms including diarrhea, a red scaly rash, and mild cerebellar ataxia. However, his diet is not deficient in protein and he appears to be ingesting adequate amounts of niacin. A sister has a similar problem. Chemical analysis of his urine demonstrates large amounts of free amino acids. Which of the following is the most likely diagnosis?

147. A surgeon performing an appendectomy makes an incision through the ventrolateral wall. Which of the following corresponds to the order of penetration of the layers of the abdominal wall?

1. Internal oblique

2. External oblique

3. Peritoneum

4. Transversus abdominis

 

148. A scientist wishes to study free radical production under ischemic conditions. He decides to produce cerebral ischemia by tying off an artery of the brain. Ligation of which of the following arteries would be most likely to produce significant ischemic damage?

149. A patient with colorectal cancer develops septicemia complicated by endocarditis. You would expect the blood cultures to grow

150. A 23-year-old man develops explosive watery diarrhea with blood, fecal leukocytes, and mucus approximately 3 days after eating chicken that was improperly cooked. Comma-shaped organisms were found in the fecal smea r along with red blood cells and leukocytes. Which of the following pathogens is the most likely cause of these symptoms?

151. A 4-year-old boy is seen by his pediatrician for epistaxis. The patient has a history of multiple bacterial and viral respiratory tract infections and eczema. An uncle had similar problems. Physical examination is remarkable for multiple petechial lesions on the skin and mucous membranes. Serum IgE is increased, and platelets are decreased. Which of the following is the most likely diagnosis?

152. A 55-year-old man presents to the emergency room with crushing substernal pain and left shoulder pain of 2 hours duration. The pain is not relieved by sublingual nitroglycerin, and the electrocardiogram shows ST elevation in several leads. Aspirin and streptokinase therapy are initiated, and the patient is admitted to the intensive care unit. The next morning, serum cardiac enzymes are elevated to 4 times the upper limit of normal, and the electrocardiographic changes are still present. Which of the following is the most likely diagnosis?

153. A macroscopic hepatic change known as nutmeg liver is indicative of

154. Which of the following hormones is secreted by anterior pituitary cells that stain with acidic dyes?

155. Which of the following characteristics most strongly suggests that the cell depicted above is a phagocytically active macrophage?

156. In the clotting process, as the hemostatic plug develops, fibrin polymerizes into monomeric threads which are held together by noncovalent bonds. Which clotting protein increases the strength of the clot by crosslinking the newly formed fibrin threads?

157. A 37-year-old female presents to the emergency room with a fever. Chest x-ray shows multiple patchy infiltrates in both lungs. Echocardiography and blood cultures suggest a diagnosis of acute bacterial endocarditis limited to the tricuspid valve. Which of the following is the most probable etiology?

158. An elderly lady is brought to the emergency room after drinking insecticide that she thought was tea. After her stomach is pumped, her sense of smell is tested and it is found that she can not distinguish common smells (e.g., an orange, coffee). CT scan of the head demonstrates a mass in the olfactory groove area. The axons likely compressed by this mass project to which of the following structures?

159. A 27-year-old man develops bilateral parotid gland swelling and orchitis, and is generally ill with fever of 102° F. Which of the following substances is most likely to be significantly elevated in the patient's serum?

160. A 2-month-old boy is evaluated for failure to thrive. As the pediatrician is examining the patient, she witnesses a seizure. Physical examination is remarkable for hepatomegaly, a finding later confirmed by CT scan, which also reveals renomegaly. Serum chemistries demonstrate severe hypoglycemia, hyperlipidemia, lactic acidosis, and ketosis. Which of the following diseases best accounts for this presentation?

161. A researcher is examining the distribution of an ion channel protein in the kidney. She incubates slices of kidney tissue in a dilute solution of a specific antibody directed against the protein, then uses the immunoperoxidase method to localize the ion channel proteins. She notes the presence of brown pigment in a population of epithelial cells, which on closer examination, have a brush border. The researcher concludes that the protein is probably present in cells of the

162. A 25-year-old man presents with a high fever and generalized malaise. His condition deteriorates so rapidly that his friends decide to take him to the emergency department 24 hours after the onset of symptoms. He has a history of intravenous drug abuse. A test for anti-HIV antibodies is negative. Physical examination reveals a systolic murmur, and echocardiography shows bulky vegetations attached to the tricuspid valve leaflets. Which of the following microorganisms will be most likely be isolated from this patient's blood cultures?

163. Which of the following enzymes is stimulated by glucagon?

164. A 1-year-old child develops voluminous watery diarrhea and vomiting. She is brought to the pediatrician by her parents and evaluated, then sent home with instructions for the parents to give the child an electrolyte replacement solution. Which of the following viruses is the most likely cause of the child's diarrhea?

165. A child who has had abnormal development of the membranous bones has a broad skull with associated facial and dental anomalies. Which other bones are most likely to also be affected?

166. 5 mL of synovial fluid is aspirated from an inflamed knee joint. The fluid is yellow-white and cloudy and contains 200,000 WBC/mm3 (85% neutrophils). Needle-shaped, strongly negatively birefringent crystals are seen both within and outside neutrophils. These crystals most likely have which of the following compositions?

167. A 30-year-old veterinarian on a cattle ranch presents with a 1-to-2-month history of malaise, chills, drenching malodorous sweats, fatigue, and weakness. He has anorexia and has lost 15 pounds. He has intermittent fevers that range up to 103 F (39.4 C). He complains of visual blurring. A physical examination reveals mild lymphadenopathy, petechiae, and a cardiac murmur consistent with aortic insufficiency. What is the most likely etiologic agent?

168. A 27-year-old man has been arrested by the police for hitting, cursing at, and verbally berating his wife of 8 years. The wife tells the police he also regularly physically whips his 7-year-old son with a leather belt and often strikes the boy with his hand. When asked why he does this, he responds that this is "how my father treated me, it's how men should act." This represents which of the following types of learning?

169. A 37-year-old woman who was diagnosed with AIDS 3 years earlier is unable to work, is physically debilitated, and requests her physician to provide her with medications with which to take her own life. The most common emotional disorder that results in such requests by patients is

170. Which of the following complications is currently the major limitation to the long-term success of cardiac transplantation?

171. Evaluation of an infant with a variety of congenital abnormalities reveals hypocalcemia due to a lack of parathyroid hormone. On x-ray, the thymic shadow is absent. A failure of development and differentiation of which of the following embryonic structures would most likely be responsible for the observed presentation?

172. A 28-year-old female presents to the doctor complaining of syncopal episodes that last a few minutes. She is not taking any medications and has no previous medical history. EEG and EKG studies are performed and are unremarkable. An echocardiogram shows a single ball-shaped mass dangling in the left atrium near the mitral valve. The most likely diagnosis is

173. A 16-year-old girl presents with a painlessly enlarged lymph node in her right axilla. Peripheral blood counts are within normal limits. The lymph node is biopsied, and numerous granulomas filled with neutrophils and necrotic debris are observed. Which of the following organisms could produce this disease?