1. HbNl: AAGUAUCACUAAGCUCGC HbCr: AAGAGUAUCACUAAGCUCGCUUUC ... UAU UAA Hemoglobin is isolated from the erythrocytes of a young child with anemia. Hemoglobin electrophoresis reveals the presence of an unstable hemoglobin, known as hemoglobin Cranston (HbCr), containing an abnormal b-globin chain. The normal sequence of the b-globin gene (HbNl) and the sequence of the HbCr b-chain are presented above. Which of the following would account for the development of HbCr?
Leave A Comment