USMLE QBANK

20 04, 2021

Q292

By |2021-04-19T19:48:18+00:00April 20, 2021|Question Banks|0 Comments

HbNl: AAGUAUCACUAAGCUCGC HbCr: AAGAGUAUCACUAAGCUCGCUUUC ... UAU UAA Hemoglobin is isolated from the erythrocytes of a young child with anemia. Hemoglobin electrophoresis reveals the presence of an unstable hemoglobin, known as hemoglobin Cranston (HbCr), containing an abnormal b-globin chain. The normal sequence of the b-globin gene (HbNl) and the sequence of the HbCr b-chain are presented above. Which of the following would account for the development of HbCr?

20 04, 2021

Q306

By |2021-04-20T07:49:27+00:00April 20, 2021|Question Banks|0 Comments

A 37-year-old female presents to the emergency room with a fever. Chest x-ray shows multiple patchy infiltrates in both lungs. Echocardiography and blood cultures suggest a diagnosis of acute bacterial endocarditis limited to the tricuspid valve. Which of the following is the most probable etiology?

20 04, 2021

Q305

By |2021-04-20T07:49:27+00:00April 20, 2021|Question Banks|0 Comments

A baby who was apparently normal at birth, develops persistent regurgitation and vomiting in the second and third weeks of life. No fever is present and hematologic studies and blood chemistries are normal. Which of the following therapies is most likely to be effective in this case?

20 04, 2021

Q304

By |2021-04-20T07:49:27+00:00April 20, 2021|Question Banks|0 Comments

A 24-year-old woman in her third trimester of pregnancy presents with urinary frequency and burning for the past few days. She denies fever, nausea, vomiting, or chills. She takes no medications besides prenatal vitamins and is generally in good health. Physical examination is remarkable for mild suprapubic tenderness, and a urine dipstick is positive for white blood cells, protein, and a small amount of blood. Culture produces greater than 100,000 colonies of gram-negative bacilli. which of the following attributes of this uropathogenic organism is most strongly associated with its virulence?

20 04, 2021

Q303

By |2021-04-20T07:49:28+00:00April 20, 2021|Question Banks|0 Comments

A 20-year-old develops weakness accompanied by difficulty in relaxation that is most pronounced in the hands and feet. Muscle biopsy demonstrates prominent ring fibers, centrally located nuclei, chains of nuclei, and disorganized sarcoplasmic masses. This condition been associated with a mutation on which of the following chromosomes?

20 04, 2021

Q301

By |2021-04-20T07:49:28+00:00April 20, 2021|Question Banks|0 Comments

A 36-year-old Asian male complains of difficulty swallowing. Esophagoscopy reveals a polypoid mass that is subsequently biopsied.  In addition to tumor cells, the esophageal biopsy show normal smooth  muscle and striated muscle in the same section. Which portion of the  esophagus was the source of this biopsy?

Go to Top