Question Banks

Five days after returning to his military base in South Carolina after survival training in the nearby countryside, an 18-year-old recruit reports to the infirmary complaining of a headache. Physical examination reveals a fever, but no other abnormalities are noted. A few days later he returns to the infirmary with a maculopapular rash involving the hands and feet. The rash then spreads centripetally to involve the trunk. Which of the following diseases should be suspected?

A previously healthy 11-year-old girl develops a gastrointestinal infection with cramping and watery stools. After several days, she begins to pass blood per rectum, and is hospitalized for dehydration. In the hospital, she is noted to have decreasing urine output with rising blood urea nitrogen (BUN). Total blood count reveals anemia and thrombocytopenia, and the peripheral smear is remarkable for fragmented red cells (schistocytes). Infection with which of the following bacterial genera is most likely responsible for this syndrome?

A 24-year-old woman in her third trimester of pregnancy presents with urinary frequency and burning for the past few days. She denies fever, nausea, vomiting, or chills. She takes no medications besides prenatal vitamins and is generally in good health. Physical examination is remarkable for mild suprapubic tenderness, and a urine dipstick is positive for white blood cells, protein, and a small amount of blood. Culture produces greater than 100,000 colonies of gram-negative bacilli. Which of the following attributes of this uropathogenic organism is most strongly associated with its virulence?

A patient is referred to a neurologist because of ataxia. Neurological examination reveals a loss of proprioception and a wide-based, slapping gate Magnetic resonance imaging reveals degeneration of the dorsal columns and dorsal roots of the spinal cord. Which of the following organisms is most likely to have caused this pattern of damage?

HbNl: AAGUAUCACUAAGCUCGC HbCr: AAGAGUAUCACUAAGCUCGCUUUC ... UAU UAA Hemoglobin is isolated from the erythrocytes of a young child with anemia. Hemoglobin electrophoresis reveals the presence of an unstable hemoglobin, known as hemoglobin Cranston (HbCr), containing an abnormal b-globin chain. The normal sequence of the b-globin gene (HbNl) and the sequence of the HbCr b-chain are presented above. Which of the following would account for the development of HbCr?

Which of the following is the primary opsonin in the complement system?

A 37-year-old female presents to the emergency room with a fever. Chest x-ray shows multiple patchy infiltrates in both lungs. Echocardiography and blood cultures suggest a diagnosis of acute bacterial endocarditis limited to the tricuspid valve. Which of the following is the most probable etiology?

A baby who was apparently normal at birth, develops persistent regurgitation and vomiting in the second and third weeks of life. No fever is present and hematologic studies and blood chemistries are normal. Which of the following therapies is most likely to be effective in this case?

A 24-year-old woman in her third trimester of pregnancy presents with urinary frequency and burning for the past few days. She denies fever, nausea, vomiting, or chills. She takes no medications besides prenatal vitamins and is generally in good health. Physical examination is remarkable for mild suprapubic tenderness, and a urine dipstick is positive for white blood cells, protein, and a small amount of blood. Culture produces greater than 100,000 colonies of gram-negative bacilli. which of the following attributes of this uropathogenic organism is most strongly associated with its virulence?

A 20-year-old develops weakness accompanied by difficulty in relaxation that is most pronounced in the hands and feet. Muscle biopsy demonstrates prominent ring fibers, centrally located nuclei, chains of nuclei, and disorganized sarcoplasmic masses. This condition been associated with a mutation on which of the following chromosomes?