Medical Tactics

About Medical Tactics

This author has not yet filled in any details.
So far Medical Tactics has created 421 blog entries.
20 04, 2021

Q313

By |2021-04-20T07:48:48+00:00April 20, 2021|Question Banks|0 Comments

A sexually active 18-year-old woman presents with a fever of 102 F for the past 24 hours and lower abdominal pain and anorexia for the past 5 days. On physical examination, there is generalized tenderness of the abdomen, and the cervix is erythematous with motion tenderness. There is no rash nor any lesions on the external genitalia. A smear of the odorless cervical discharge contains sloughed epithelial cells and scant neutrophils. Which of the following would likely be found in the exudate?

20 04, 2021

Q312

By |2021-04-20T07:48:48+00:00April 20, 2021|Question Banks|0 Comments

A 32-year-old, blood type A positive male receives a kidney transplant from a blood type B positive female donor with whom he had a 6-antigen HL A match. Once the kidney is anastomosed to the man's vasculature, the transplant team immediately begins to observe swelling and interstitial hemorrhage. After the surgery, the patient developed fever and leukocytosis and produced no urine. Which of the following is the most likely explanation?

20 04, 2021

Q311

By |2021-04-20T07:48:48+00:00April 20, 2021|Question Banks|0 Comments

Five days after returning to his military base in South Carolina after survival training in the nearby countryside, an 18-year-old recruit reports to the infirmary complaining of a headache. Physical examination reveals a fever, but no other abnormalities are noted. A few days later he returns to the infirmary with a maculopapular rash involving the hands and feet. The rash then spreads centripetally to involve the trunk. Which of the following diseases should be suspected?

20 04, 2021

Q310

By |2021-04-20T07:48:48+00:00April 20, 2021|Question Banks|0 Comments

A previously healthy 11-year-old girl develops a gastrointestinal infection with cramping and watery stools. After several days, she begins to pass blood per rectum, and is hospitalized for dehydration. In the hospital, she is noted to have decreasing urine output with rising blood urea nitrogen (BUN). Total blood count reveals anemia and thrombocytopenia, and the peripheral smear is remarkable for fragmented red cells (schistocytes). Infection with which of the following bacterial genera is most likely responsible for this syndrome?

20 04, 2021

Q309

By |2021-04-20T07:48:48+00:00April 20, 2021|Question Banks|0 Comments

A 24-year-old woman in her third trimester of pregnancy presents with urinary frequency and burning for the past few days. She denies fever, nausea, vomiting, or chills. She takes no medications besides prenatal vitamins and is generally in good health. Physical examination is remarkable for mild suprapubic tenderness, and a urine dipstick is positive for white blood cells, protein, and a small amount of blood. Culture produces greater than 100,000 colonies of gram-negative bacilli. Which of the following attributes of this uropathogenic organism is most strongly associated with its virulence?

20 04, 2021

Q308

By |2021-04-20T18:37:28+00:00April 20, 2021|Question Banks|0 Comments

A patient is referred to a neurologist because of ataxia. Neurological examination reveals a loss of proprioception and a wide-based, slapping gate Magnetic resonance imaging reveals degeneration of the dorsal columns and dorsal roots of the spinal cord. Which of the following organisms is most likely to have caused this pattern of damage?

20 04, 2021

Q292

By |2021-04-19T19:48:18+00:00April 20, 2021|Question Banks|0 Comments

HbNl: AAGUAUCACUAAGCUCGC HbCr: AAGAGUAUCACUAAGCUCGCUUUC ... UAU UAA Hemoglobin is isolated from the erythrocytes of a young child with anemia. Hemoglobin electrophoresis reveals the presence of an unstable hemoglobin, known as hemoglobin Cranston (HbCr), containing an abnormal b-globin chain. The normal sequence of the b-globin gene (HbNl) and the sequence of the HbCr b-chain are presented above. Which of the following would account for the development of HbCr?

20 04, 2021

Q306

By |2021-04-20T07:49:27+00:00April 20, 2021|Question Banks|0 Comments

A 37-year-old female presents to the emergency room with a fever. Chest x-ray shows multiple patchy infiltrates in both lungs. Echocardiography and blood cultures suggest a diagnosis of acute bacterial endocarditis limited to the tricuspid valve. Which of the following is the most probable etiology?

20 04, 2021

Q305

By |2021-04-20T07:49:27+00:00April 20, 2021|Question Banks|0 Comments

A baby who was apparently normal at birth, develops persistent regurgitation and vomiting in the second and third weeks of life. No fever is present and hematologic studies and blood chemistries are normal. Which of the following therapies is most likely to be effective in this case?

Go to Top